ESTScan Details for Unigene SGN-U212839

Score 
165
Direction 
Reverse
Predicted Peptide Sequence 
VAVGVVKNVDKKDPTGAKVTKAAQKKGKXNCAVDAGVSNAFIYIECAI
Predicted Coding Sequence 
XXTGTTGCTGTCGGTGTTGTCAAGAATGTTGACAAGAAGGACCCAACTGGTGCCAAGGTGACCAAGGCTGCCCAGAAGAAGGGGAAGXTG
AACTGTGCAGTTGATGCTGGTGTTTCGAATGCATTTATTTACATCGAGTGTGCTATCTAG\
Edits in Original Sequence 
(5')XXTGTTGCTGTCGGTGTTGTCAAGAATGTTGACAAGAAGGACCCAACTGGTGCCAAGGTGACCAAGGCTGCCCAGAAGAAGGGGAA
GXTGAACTGTGCAGTgTGATGCTGGTGTTTCGAATGCtATTTATTTACATCGAGTGTGCTATCTAG\(3')ACTCTGTTTTATTTAATTC
TGCTTTAGTTTGGTCTTTGAGTTGTGTATTAGGTTGTAGTTCTCTGACTTGTATCTCAAGTATCCATTCTCAGAACTGGGTACTTGATAG
GCGGTGGCGAGCATGATTTTGAGTCTGTTATCATTTGCTTTTGTTGAGGTGCCTTGGTTTGTTTTCCATGGTGGCTCAGGATTTTTGTTG
CTTTAATTTGAGATTTAAGTTTTCTACTCATTACGTTACATTTAAGTTAACATGTTACCTTTGCTAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAA

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan