ESTScan Details for Unigene SGN-U223128

Score 
136
Direction 
Reverse
Predicted Peptide Sequence 
MPDVAINPEEVPSEDL
Predicted Coding Sequence 
ATGCCTGATGTCGCGATCAATCCAGAAGAGGTGCCTTCTGAAGACTTGTAA\
Edits in Original Sequence 
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGAGGTGATTGTAGTGACAATCAAACAGAGTTATCA(5')ATGCCTGATGTCGCGATCA
ATCCAGAAGAGGTGCCTTCTGAAGACTTGTAA\(3')TATTGGTAATGTAAACAGTTTACAATAATCATTGGTAGCTAAACTTTGTTACC
AAAACTCATTCTAGAGGAAATTCTCCTCTCACATATTTAACTGTATATACTACTAGAGGTGATGTGGCTTCTAATAATTGTGATTATAGT
GACCGACTCTTCTACCTTGTGCATTCCACCTCTGCTAAGGTGCTATCACGCATGGGGTAGATGTAACTCAGACAACCCTGAAAGACTCAG
CGATCTTTCTCAAATCTTTGTAATACCTTTTCCATTGAAGACCATTTCCAGTAACATTGAACAAGTATAGGCGATTTCCAGCAGCCGTTG
CTGTGATCATCACATGTGGTGGCTCTAATTCAAACTGGTAATATGTTCTTCCCTCATGCTCTGCTACTTCAGATCTTAAGACTTTACCTT
CAACATTCTCTCCA

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan