ESTScan Details for Unigene SGN-U234374

Score 
164
Direction 
Forward
Predicted Peptide Sequence 
MGLSQYPTPADAGVLCVILVNTAISIS
Predicted Coding Sequence 
ATGGGACTCTCACAGTATCCAACTCCAGCAGATGCAGGAGTGCTCTGTGTTATTCTAGTGAACACAGCCATATCCATCTCX\
Edits in Original Sequence 
TTCATCCGGCACGAGGTCCTGCTTCTGTCTCTTTGAACTGCTTTTTACTCATATTTTAGTCTTTCTTGATGATGGATGATGATTTACCTT
GGATCTTCACATTTTATTCAATATTGAAAAGTTCTGGTTTTGGGTGTTTTATTACATGATTTGTAATTTGTGGTCTGAGATTTCCTTGTT
ATCTTGAAAAGGGTTTTTTTTTTCTCCTTTGTCTATTTACATTTGGTATCAGGAAAATGAAATTATTACAGTTTTTTAGCAGAAGTTTTT
CTGGTTCTTGGATCCATGTTCATAAAGATTTGTTTTTTCAAAGGAATAAAACTGAACTTTTAAAGGAAGATGAGGACTTTCTAATCAATG
GGGTTTCCATTTCTTGTTTGAGATGTGTAACATAGCTCCAATTTTCATTTCTTGATGCTTTTCTTGGAGGACTGTGTTCCATTTATAATT
GTCTTACTGCTGTGGGTTGTTTAACTTTTCCTCATAATTGACTTATAGATTCTTGTTTCTATGCAGGTCCAGTTCAGTCAGCTGTTCCAG
AAGTTGTTGCTAGTAGAAATCTCTAAGTTTCAGC
(5')ATGGGACTCTCACAGTATCCAACTCCAGCAGATGCAGGAGTGCTCTGTGTTA
TTCTAGTGAACACAGCCATATCCATCTCX\(3')ACAGCCATATCCATCTCCATTTGTCAGGAGATGGTCCGATCGATCCTTCATGTGAT
TGGCATCCACATTGCATCA

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan