ESTScan Details for Unigene SGN-U238574

Score 
51
Direction 
Reverse
Predicted Peptide Sequence 
FLNYGPENEGXLVPKNKKGKLLAGWGHKP
Predicted Coding Sequence 
XGTTTTTTGAACTATGGTCCTGAAAACGAAGGTXTTTTGGTCCCAAAGAACAAAAAAGGGAAGCTTTTAGCTGGGTGGGGGCATAAGCCA
TAA\
Edits in Original Sequence 
(5')XGTTTTTTGAACTATGGTCCTGAAAACGAAGGTXTTTTGGTCCCAAAGAACAAAAAAGGGAAGCTTTTAGCTGGGTGGGGGCATAA
GCCATAA\(3')AGCAAAAACATTTGGGGGGGGGAGGTATATAAAAAGATTGGCTTTGGGTATTGGTGAGGGGTTTGCTGTTGAAATCCC
CCCACATCCGGGTAATGGGGTTAGATTTGCAAAAAAAGTGAGGGGTGGGGGGAAAAATCAAGAACCTGGTTAATGGGTGGGGGGGGTTTT
TTTTTTGGGGAATTTAATATATAGGTTTTAAAAAATATTTTCCCCCCGGCCCTT

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan