ESTScan Details for Unigene SGN-U239759

Score 
334
Direction 
Forward
Predicted Peptide Sequence 
MKMKEIPTLPQDIIIEILIRLPLKTLLKFRSVSKSWLYLLSDAQFHKTHISFSTNNPKFTDYTLAAIPTLSGLGKICHVYTISSENSSVI
VSNMGVLLRLSLSRLGFWGLVMG
Predicted Coding Sequence 
ATGAAGATGAAAGAAATACCAACTCTTCCTCAAGACATCATCATTGAAATTCTCATCAGGTTACCTCTCAAAACTCTCTTGAAATTCAGG
TCTGTTTCCAAATCATGGCTTTATTTACTCTCAGATGCACAATTCCATAAAACCCATATCAGTTTTTCTACGAACAATCCCAAATTTACC
GACTACACCCTTGCTGCTATACCCACTCTTTCTGGTTTGGGCAAAATTTGTCATGTCTACACTATAAGCTCTGAAAATTCATCTGTTATT
GTGTCAAACATGGGTGTCCTTCTAAGACTCTCTCTCTCTCGGCTTGGATTTTGGGGTCTTGTAATGGGTTAA\
Edits in Original Sequence 
GCATCATTTTACTTTCACATATTCTCTCTTTAACTCCTCTCACTATCTTCTTCTTTCTAAAAGCTACTTTTTCTGTTGCAATACATATAT
ATTTTTCAA
(5')ATGAAGATGAAAGAAATACCAACTCTTCCTCAAGACATCATCATTGAAATTCTCATCAGGTTACCTCTCAAAACTCT
CTTGAAATTCAGGTCTGTTTCCAAATCATGGCTTTATTTACTCTCAGATGCACAATTCCATAAAACCCATATCAGTTTTTCTACGAACAA
TCCCAAATTTACCGACTACACCCTTGCTGCTATACCCACTCTTTCTGGTTTGGGCAAAATTTGTCATGTCTACACTATAAGCTCTGAAAA
TTCATCTGTTATTGTGTCtAAACATGGGTGTCCTTCTAAGACTCTCTCTCTCTCGGCTTGGATTTTGGGGTCTTGTAATGGGTTAA\(3')
AATTTGCTTAACTTCTGATTCCTTTAATTTAATGTTATTGAACCCGTGTACTGGAAAGTTTAGTTTATTTCCTGATTTGATGATTGAGT
ATGAAG

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan