ESTScan Details for Unigene SGN-U240408

Score 
24
Direction 
Forward
Predicted Peptide Sequence 
MGNQGQDMSMAIYKNSNFTGGCLEIRLFYVRITPCAVETVPDHLILRHLRREMGVTLEINSSRIPANDTGIITLRRDRVDKESSEVTFVS
TDSVRVSGPVEFEVHENENELILCGX
Predicted Coding Sequence 
ATGGGTAATCAAGGTCAGGATATGTCAATGGCAATCTACAAAAACTCGAATTTCACCGGAGGTTGTTTGGAAATCCGATTGTTTTATGTA
CGTATCACGCCATGCGCGGTTGAAACCGTACCGGACCACCTCATACTCCGCCACCTCCGCCGTGAGATGGGGGTAACGTTAGAGATCAAC
AGTTCGCGTATTCCGGCTAATGATACAGGCATCATAACCCTCCGACGTGATCGGGTTGATAAGGAATCGTCGGAGGTAACGTTTGTGAGC
ACGGACAGCGTTAGGGTTTCAGGGCCGGTGGAATTTGAGGTACATGAGAATGAAAATGAGTTAATACTTTGTGGGTXX\
Edits in Original Sequence 
GCTTTTAATCCTTTCTCTCGCCATGTTCACACATAACGAAACATCTACACTATTTCTCAACCGATCCATGTGTGATTTTTATGGATCCTT
AACCTTGAATTTTGTTCAATTCTCCTTGTTAATCAATGATCAATTTCCTTCAATTTTTGTAGATTGAAGAAAAAATTGGGAT
(5')ATGG
GTAATCAAGGTCAGGATATGTCAATGGCAATCTACAAAAACTCGAATTTCACCGGAGGTTGTTTGGAAATCCGATTGTTTTATGTACGTA
TCACGCCATGCGCGGTTGAAACCGTACCGGACCACCTCATACTCCGCCACCTCCGCCGTGAGATGGGGGTAACGTTAGAGATCAACAGTT
CGCGTATTCCGGCTAATGATACAGGCATCATAACCCTCCGACGTGATCGGGTTGATAAGGAATCGTCGGAGGTAACGTTTGTGAGCACGG
ACAGCGTTAGGGTTTCAGGGCCGGTGGAATTTGAGGTACATGAGAATGAAAATGAGTTAATACTTTGTGGGTXX\(3')GTCGTTGGAGA
GAGTAGAGACAACGTGGGCTAATGGTAATGTTTTAGAGAATGATT

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan