ESTScan Details for Unigene SGN-U240854

Score 
112
Direction 
Forward
Predicted Peptide Sequence 
KGLLSVTMEELQELVDDIKTLRD
Predicted Coding Sequence 
AAAGGCCTCCTGAGTGTGACAATGGAGGAACTTCAAGAACTTGTGGATGATATAAAGACTCTTCGCGACTAA\
Edits in Original Sequence 
(5')AAAGGCCTCCTGAGTGTGACAATGGAGGAACTTCAAGAACTTGTGGATGATATAAAGACTCTTCGCGACTAA\(3')ATCAGTGGC
TTAATTCTCTAGTGCTGTAAAGAAGTGCTCGTGTAGATTCCTAGTTATGTAAGAAGTTTTTGATGTGATATATTTCTTCGTTTTGAAATG
CCTAAAATGTGAGAGATAACAGTAAGCAGTTTACTATGACATGATTAATGACAAGTATGGAAAAACAAATAGCTAAAACCTCTTG

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan