ESTScan Details for Unigene SGN-U253220

Score 
177
Direction 
Reverse
Predicted Peptide Sequence 
MDVYPDPYGDPAVIPLKX
Predicted Coding Sequence 
ATGGATGTTTATCCTGACCCTTATGGTGATCCAGCTGTCATCCCTTTGAAAGXX\
Edits in Original Sequence 
TTTTTTTTTTTAAATAAAATTTGAAGTGATATATATTCCCCAAAGTATGTATATGTATCAATATAGAAACATGAATTTAATAATTACAAT
TATACAAATGTTATATCAACTTAAAATTATGAGTCTCATAAAGTTGCCCTCAAGAACTGTACGACAAAATATATAACTGCCAGCAGCAAT
GCAATTTGGTAAAAATCTCTCTGGAAGCTGTCATCCCTTTGAAAGAACTTTGCTGGATCACCATAAGGGTCAGAATAAAAAC
(5')ATGG
ATGTTTATCCTGACCCTTATGGTGATCCAGCTGTCATCCCTTTGAAAGXX\(3')

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan