ESTScan Details for Unigene SGN-U259824

Score 
0
Direction 
Reverse
Predicted Peptide Sequence 
NULL
Predicted Coding Sequence 
NULL
Edits in Original Sequence 
GCTCAAAACTTTTTCCTTTATATCATCCCTTTTTCTTCACGTATCTTCTACAACTAAAAGAAAGAACCCATTTTTTGGAAAATTGGTTCT
TGAAAGGATAAAGATTGAATCTTTTTTGTGTTTTATGAAATGGGTGGTCAGTGTCAAGAAAATATTTTGGGTACTG
(5')NULL(3')GC
TCAAAACTTTTTCCTTTATATCATCCCTTTTTCTTCACGTATCTTCTACAACTAAAAGAAAGAACCCATTTTTTGGAAAATTGGTTCTTG
AAAGGATAAAGATTGAATCTTTTTTGTGTTTTATGAAATGGGTGGTCAGTGTCAAGAAAATATTTTGGGTACTGG

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan