ESTScan Details for Unigene SGN-U264052

Score 
127
Direction 
Reverse
Predicted Peptide Sequence 
TASTLTLGMGLVHLGLAVSTSINTXDGRLEEVVLRHLGSEDGSTVIAKNIRLSDFLRNLEIR
Predicted Coding Sequence 
ACTGCAAGCACTTTGACTTTGGGAATGGGACTTGTCCATTTGGGACTAGCTGTTTCTACAAGCATCAACACCGXTGATGGTCGTCTGGAG
GAAGTGGTACTACGCCATCTTGGTTCTGAAGATGGAAGCACAGTAATCGCTAAAAATATCAGGCTCTCGGACTTCCTTAGGAATTTGGAA
ATTAGGTGA\
Edits in Original Sequence 
(5')ACTGCAAGCACTTTGACTTTGGGAATGGGACTTGTCCATTTGGGACTAGCTGTTTCTACAAGCATCAACACCGXTGATGGTCGTCT
GGAGGAAGTGGTACTACGCCATCTTGGTTCTGAAGATGGAAGCACAGTAATCGCTAAAAATATCAGGCTCTCGGACTTCCTTAGGAATTT
GGAAATTAGGTGA\(3')ACAGTTTCTTTTAGTAATTTCAAGAGTAAACTTCCCCTGGTGGATATTGGCTGCTGAGATGGGCTTGGATTT
AACTGTTTGTGAGTGGTATACAAAAAAACATAAAAAAAAGTTGATGATTTATTGCCGATTACAGGTCCTGCTAATGTCCAGGGTGATAAT
TCTTAAAATGACGTTTTTTTCTTCTTTGGTGATACACATTGTATATCTGATCTTGTGATAGATTTTTCCTTTGTTATTACTATTTTATTT
GAAAGCCTTAAATTTAAAAGTCTAAAATATTTAATGAACCGGGAGTGAGATAAAAGAT

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan