ESTScan Details for Unigene SGN-U286386

Score 
102
Direction 
Reverse
Predicted Peptide Sequence 
MSKNMMTSRTLVMLILVITYSIAVKGSNGHPCSSTFFSALIQLIPCRASGGSVQFGTTERSVLRFHQGIRAAVSVVLINGPPISGVDRSM
AVQLPDKCTANFEQCEFGK
Predicted Coding Sequence 
ATGAGCAAAAACATGATGACTAGTCGTACTTTAGTAATGCTAATATTAGTAATAACATACAGTATCGCGGTGAAAGGAAGCAATGGTCAT
CCTTGTAGCAGCACATTCTTTTCAGCGTTGATTCAGCTGATACCTTGTAGGGCATCXGGTGGTTCCGTTCAGTTCGGTACCACCGAGCGA
AGCGTGCTGCGCTTCCATCAAGGCATTAGGGCAGCCGTGTCTGTTGTTCTTATCAATGGCCCTCCTATTTCTGGTGTTGATCGAAGCATG
GCCGTACAGCTTCCTGATAAGTGCACTGCTAACTTTGAACAATGTGAATTTGGAAAGTAG\
Edits in Original Sequence 
TAGTAGTCCAAAATTTTAAAAAT(5')ATGAGCAAAAACATGATGACTAGTCGTACTTTAGTAATGCTAATATTAGTAATAACATACAGT
ATCGCGGTGAAAGGAAGCAATGGTCATCCTTGTAGCAGCACATTCTTTTCAGCGTTGATTCAGCTGATACCTTGTAGGGCATCXGGTGGT
TCCGTTCAGTTCGGTACCACCGAGCGAAGCGTGCTGCGCTTCCATCAAGGCATTAGGGCAGCCGTGTCTGTgTGTTCTTATCAATGGCCC
TCCTATTTCTGGTGTTGATCGAAGCATGGCCGTACAGCTTCCTGATAAGTGCACTGCTAACTTTGAACAATGTGAATTTGGAAAGTAG\
(3')GAATACTAGATTGATTCTAGTAGGTATGGTGAAGGAAGAAGTCTAGATCAATAAATATGTGCAGGGGAGCTTAGCAACTCTGAACAA
TTAGAAATATGTACTAAATCAAATTAAGTGTTTACTTAATTGTTATAATAGTTTATTTAGCTCGTCTTAATATCATTGTTATGGTAATAA
TGGCCAACATTAGTATTATGTAATGCAAAATGGTCGCCCTTGAAACGGTAATTAAACATTACTCCTCAAGGAATTAGTGAATATTTGTCA
AAAAA

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan