ESTScan Details for Unigene SGN-U290523

Score 
258
Direction 
Forward
Predicted Peptide Sequence 
MDRVVKIASQKAVVIFSKSSCCMCHAIKRLFYEQGVSPMIYELDEDMNGRDMERSLLRLGCSPAVPAVFIGGRFVGSANTVMTLHINGSL
KKMLKDAGALWL
Predicted Coding Sequence 
ATGGATCGTGTAGTGAAAATTGCATCACAAAAGGCAGTTGTGATATTTAGCAAGAGTTCATGTTGCATGTGTCATGCAATTAAGAGGTTA
TTTTACGAGCAAGGTGTTAGCCCTATGATTTATGAACTTGATGAAGATATGAATGGACGCGATATGGAGAGATCTCTCCTCAGGTTAGGC
TGTAGCCCGGCTGTACCAGCCGTGTTTATTGGTGGTCGATTTGTGGGATCAGCTAACACTGTTATGACACTTCATATCAATGGTTCACTC
AAGAAGATGCTTAAAGATGCGGGAGCTCTATGGCTTTAGTGA\
Edits in Original Sequence 
GTCTCTAGCAAATCCAACTTCAAGAAAACAACTTATAAACCCTATATATTTCATAAATATAAACAAATCAAATTAAATAATAATCGAT(5')
ATGGATCGTGTAGTGAAAATTGCATCACAAAAGGCAGTTGTGATATTTAGCAAGAGTTCATGTTGCATGTGTCATGCAATTAAGAGGT
TATTTTACGAGCAAGGTGTTAGCCCTATGATTTATGAACTTGATGAAGATATGAATGGACGCGATATGGAGAGATCTCTCCTCAGGTTAG
GCTGTAGCCCGGCTGTACCAGCCGTGTTTATTGGTGGTCGATTTGTGGGATCAGCTAACACTGTTATGACACTTCATATCAATGGTTCAC
TCAAGAAGATGCTTAAAGATGCGGGAGCTCTATGGCTTTAGTGA\(3')TGAGACACCCTTTGCTTATATATATATATATATATATATAT
ATATATATATAAAACAAGGCCTTTCTTTTTTTGGGCCTCTTTTTTTCCTTTTTAAATTTTGTACTTTGTTTCAAACTTCTTCCTTCATGG
CTTTTTATTTTTATATAATAGGCCATGATCTTTATGAGAAGTGCTAAATGCTGAATGCAATTTCTCTTTAAAAAAATAGAAATGCAACAA
TGTTTATAAGTGTGTA

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan