ESTScan Details for Unigene SGN-U291981

Score 
14
Direction 
Forward
Predicted Peptide Sequence 
MTGNIGDEVFACGDRIMRGSL
Predicted Coding Sequence 
ATGACGGGAAATATCGGGGATGAGGTATTCGCTTGTGGGGATAGAATTATGAGGGGATCTCTT\
Edits in Original Sequence 
AACTTCCGTCGTCGTCTTCATTTTTCTCATTTTCCCCTAATTTTTTTTCTCTTCCCATTTTACCCTTCTGCAAGATCTCTTAATCCTCCA
TCCCTCTATATTTTCCGGTGTAAATTTCCACCATATTCAAGGGCATTTGCGGATAATTTAATCGATTTCTTTTTATTTCGCCGGAGAAGT
TCCATTGGAA
(5')ATGACGGGAAATATCGGGGcATGAGGTATTCGCTTGTGGGGATAGAATTATGAGGGGATCTCTT\(3')

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan