ESTScan Details for Unigene SGN-U298554

Score 
159
Direction 
Forward
Predicted Peptide Sequence 
EKAMEVQRGFPLLKQQYKALIKKNYLVAMAEQDGHISSAFRIALLHLPSIPNPESYEARFSSSTSYKDVRDPEPLVSPPIPPCEDKNFIT
FPCYDFVWSGSQSTKIGQIVNGIMANNPG
Predicted Coding Sequence 
GAGAAAGCCATGGAAGTGCAGAGGGGATTCCCTTTGCTGAAACAGCAGTACAAAGCCTTAATAAAGAAGAATTATTTAGTCGCXATGGCG
GAACAAGATGGCCACATTTCTTCAGCTTTTCGCATCGCTCTTCTTCATCTTCCTTCTATTCCTAATCCAGAGAGCTATGAAGCTCGCTTC
TCTTCTTCCACATCCTATAAGGATGTGCGGGACCCAGAACCTCTGGTGTCGCCGCCAATTCCGCCTTGTGAGGACAAAAACTTCATCACT
TTCCCCTGCTATGATTTTGTTTGGAGTGGCTCTCAGAGTACGAAAATCGGTCAGATTGTAAACGGAATTATGGCTAATAATCCTGGC\
Edits in Original Sequence 
(5')GAGAAAGCCATGGAAGTGCAGAGGGGATTCCCTTTGCTGAAACAGCAGTACAAAGCCTTAATAAAGAAGAATTATTTAGTCGCXAT
GGCGGAACAAGATGGCCACATTTCTTCAGCTTTTCGCATCGCTCTTCTTCATCTTCCTTCTATTCCTAATCCAGAGAGCTATcGAAGCTC
GCTTCTCTTCTTCCACATCCTATAAGGATGTGCGGGACCCAGAACCTCTGGTGTCGCCGCCAATTCCGCCTTGTGAGGACAAAAACTTCA
TCACTTTCCCCTGCTATGATTTTGTTTGGAGTGGCTCTCAGAGTACGAAAATCGGTCAGATTGTAAACGGAATTATGGCTAATAATCCTG
GC\(3')

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan