ESTScan Details for Unigene SGN-U298655

Score 
420
Direction 
Forward
Predicted Peptide Sequence 
MAXDGSILLLALLAISMLANTVMAANGKHHHAKKYGPGSLKPCNVYHNVRGGVARHSTTSHACSSAKNVATSVCVFHLVLMETRLFVPVT
NNWKTKEGGPKCP
Predicted Coding Sequence 
ATGGCTAAXGATGGTTCAATTCTCCTTTTGGCCCTCCTTGCCATCTCCATGCTTGCTAACACTGTTATGGCTGCAAATGGCAAACACCAC
CATGCTAAAAAGTATGGACCAGGGAGCTTGAAGCCCTGCAATGTCTACCACAATGTACGAGGAGGTGTAGCAAGACACAGTACCACAAGC
CATGCATGTTCTTCTGCCAAAAATGTTGCAACAAGTGTTTGTGTGTTCCACCTGGTACTTATGGAAACAAGGCTGTTTGTCCCTGTTACA
AACAACTGGAAGACCAAGGAAGGAGGACCCAAATGCCCTTAA\
Edits in Original Sequence 
ACTTCTATACTCACAAAGTATACTTTGCTCTCCCATTTTCACTAAGAAAATCAAGC(5')ATGGCTAAXGATGGTTCAATTCTCCTTTTG
GCCCTCCTTGCCATCTCCATGCTTGCTAACACTGTTATGGCTGCAAATGGCAAACACCACCATGCTAAAAAGTATGGACCAGGGAGCTTG
AAGCCCTcGCAATGTCTACCACAATGTACGAGGAGGTGTAGCAAGACACAGTACCACAAGCCATGCATGTTCTTCTGCCAAAAATGTTGC
AACAAGTGTTTGTGTGTTCCACCTGGTACTTATGGAAACAAGGCTGTTTGTCCCTGTTACAAACAACTGGAAGACCAAGGAAGGAGGACC
CAAATGCCCTTAA\(3')ATTACTTTCTATTTTCTTCATCTAATATGTCTACCTTATCTTCTTGTTTTTTTCTCCTATTGCACTTTTATC
TAACCCAAGTGGTTATATATGTAATATGACCATATTTCCAGTTTGAATGGAACAAAAAATATTACTTGCAAAAAAAAAAAA

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan