ESTScan Details for Unigene SGN-U328840

Score 
462
Direction 
Forward
Predicted Peptide Sequence 
HAVSWFTGEAAEDDFADLEDEDDEDDDEVDDEEDEDEDDDEDDEDDEDEDDSSTKKKVLTSLISGLNNXFGEMVMNANVFPLVSNVTTSS
SAARKDESLAHVSSKQVLSCAFAFTILDXTELFIFMSQKIGRAHAADGPAGXEATGVQATVVIRFELAS
Predicted Coding Sequence 
XCTCATGCAGTTTCTTGGTTCACTGGGGAAGCTGCCGAAGATGATTTTGCTGACTTGGAAGATGAGGATGATGAAGATGATGACGAAGTG
GATGATGAAGAGGACGAGGACGAGGATGATGATGAAGATGATGAGGATGATGAGGATGAAGATGATAGCAGTACCAAGAAAAAGGTACTT
ACTTCCTTGATTAGTGGXCTAAATAATXTATTTGGAGAGATGGTCATGAATGCTAACGTTTTCCCCCTTGTTTCAAATGTTACTACATCA
TCATCTGCTGCTCGCAAGGATGAATCACTTGCTCATGTTTCTTCAAAACAAGTTCTTTCATGTGCTTTCGCTTTCACAATACTAGACATX
ACTGAGTTGTTTATATTCATGTCACAGAAGATTGGTAGGGCACATGCAGCAGATGGTCCGGCTGGTGXAGAGGCCACCGGAGTGCAAGCA
ACAGTAGTCATTCGTTTCGAGCTGGCTTCATGA
Edits in Original Sequence 
(5')XCTCATGCAGTTTCTTGGTTCACTGGGGAAGCTGCCGAAGATGATTTTGCTGACTTGGAAGATGAGGATGATGAAGATGATGACGA
AGTGGATGATGAAGAGGACGAGGACGAGGATGATGATGAAGATGATGAGGATGATGAGGATGAAGATGATAGCAGTACCAAGAAAAAGGT
ACTTACTTCCTTGATTAGTGGXCTAAATAATXTATTTGGAGAGATGGTCATGAATGCTAACGTTTTCCCCCTTGTTTCAAATGTTACTAC
AgTCATCATCTGCTGCTCGCAAGGtATGAATCACTTGCTCATGTTTCTTCAAAACAAGTTCTTTCATGTGCTTTCGCTTTCACAATACTA
GACATXACTGAGTTGTTTATATTCATGTCACAGAAGATTGGTAGGGCACATGCAGCAGATGGTCCGGCTGGTGXAGAGGCCACCGGAGTG
CAAGCAACAGTAGTCATTCGTTTCGAGCTGGCTTCATGA(3')TATTTGTCTTGAAAATATGGATGACAGAGGAGATCCTGCAATTTTGT
TTGCTTGTTGTTCGTCGAGTATGCTAGAACAATCTTTTTAGTCATTTTGCATTATATATGTTTTCTGGTTTACATTCTTTGCCTTTTGCA
GTTTGCCCTTTTATATTCCTGGTGTAGTAGTAGTAGTAGTAGATAGGATTTGGAAGTGTGATGAGACTTGTTTGTACTCTTATTGAATTG
GTTGGAGATTCAAAAATCTCAAATATAGCTTTAGTTGCAAGATATTTTTCTCCTTCCTGTGTTTCATAAGGTGTTTGTAAGGTTGACTCT
AAAAACTAAAACTTTTTAAAGCTCGTTTCCACTTGTTGTATTACATGGGGTATGCGGAGATTGT

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan