ESTScan Details for Unigene SGN-U332683

Score 
157
Direction 
Forward
Predicted Peptide Sequence 
RIASKLLEVDPRDSAGYVQLSNALASWGDGMIVREVRRKMRSEGITKEPGCSMIEVDGVVHEFLAGEGKYCNKDKILLVATEDDPVW
Predicted Coding Sequence 
XAGCGCATCGCTTCCAAACTTTTAGAGGTTGATCCTCGCGACAGTGCTGGTTATGTTCAACTATCAAATGCCCTTGCATCATGGGGAGAT
GGGATGATTGTGAGGGAAGTGCGTAGAAAGATGAGGAGCGAGGGGATAACTAAAGAGCCTGGTTGTAGTATGATTGAAGTTGATGGAGTT
GTTCATGAGTTCTTGGCTGGTGAAGGGAAATACTGTAACAAGGACAAAATACTTCTTGTAGCAACTGAAGATGATCCAGTCTGG
Edits in Original Sequence 
(5')XAGCGCATCGCTTCCAAACTTTTAGAGGTTGATCCTCGCGACAGTGCTGGTTATGTTCAACTATCAAATGCCCTTGCATCtATGGG
GAGATGGGATGATTGTGAGGGAAGTGCGTAGAAAGATGAGGAGCGAGGGGATAACTAAAGAGCCTGGTTGTAGTATGATTGAAGTTGATG
GAGTTGTTCATGAGTTCTTGGCTGGTGAAGGGAtAATACTGTAACAAGGACAAAATACTTCTTGTAGCAACTGAcAGATGATCCAGTCTG
G(3')TGAAGAATGGGGTTTGTCTTTCTTTATGAAAACCAAACTGTTGCTTATATTGATAGAAATGGCTTTTTTTGTAACAGAAGCAAAC
AGTTTGTGGTAAACTATAACAAGCAGCTAAGATCCTAGAAGCAGCAATAAGCAATGTCTGTAATTTAAAAAAAAAAAAAAAAA

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan