ESTScan Details for Unigene SGN-U333648

Score 
-166
Direction 
Forward
Predicted Peptide Sequence 
IGQRPGRGGLRIGRSSASSLTXLAALGRSAAAAVSAHSKAVIRLSTESGDNXRKEHVSQRPAKGQEP
Predicted Coding Sequence 
ATCGGCCAACGCCCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGAXCTCGCTGCGCTCGGTCGTTCGGCT
GCGGCGGCGGTATCAGCTCACTCCAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACXGCAGGAAAGAACATGTGAGCCAAAGG
CCAGCAAAAGGCCAGGAACCCTAA
Edits in Original Sequence 
TTTTTTTTTTTTTTTTTTTTATAGAACAAGCGACGATATTATCCATAAAGACCAGTTCTAAATGGGAGGGCTAAAAGCAAGCCTTTAATA
ACAATACGCTCATGTAGTTCTACGCTAACCTTGTCCGAACAAGCCAGCCCCACGTCGATGTTCATCTCAAGACCAACAAAATTTCCTAGC
AAAGATAGTTATATCGATCACACTTGAAGTCCTTGTGGAGCAGCAGGTGCAGCAACCTTAGGCTTTGGCTTCTCGACCACTATTGCTTGT
GTGGTCAGCACCATTCCTG
(5')ATCGGCCAACGCCCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGAXC
TCGCTGCGCTCGGTCGTTCGGCTGCGGCGaGCGGTATCAGCTCACTCCAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACXGC
AGGAAAGAACATGTGAGCCAAAGGCCAGCAAAAGGCCAGGAACCCTAA(3')

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan