Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

ESTScan Details for Unigene SGN-U336239

Score 
-84
Direction 
Reverse
Predicted Peptide Sequence 
LPFRLRXFXKGDRXALFVITPAAKGGMCXKXIKFGTXRFFPSGVGKPRPGNVNPTHYRAELVPGP
Predicted Coding Sequence 
XXTTTGCCATTCAGGTTGCGCANCTTTNGGAAAGGCGATCGTTNCGCCCTTTTCGTTATTACCCCAGCTGCGAAAGGGGGGATGTGTNCA
AAGNCGATTAAGTTTGGTACCGNCAGGTTTTTCCCATCAGGCGTTGGTAAACCGAGGCCAGGGAATGTTAATCCGACTCACTATAGGGCC
GAATTGGTNCCCGGCCCC
Edits in Original Sequence 
(5')XXTTTGCCATTCAGGTTGCGCANCTTTNGGAAAGGCGATCGTTNCGCCCTTTTCGTTATTACCCCAGCTGCGAAAGGGGGGATGTG
TNCAAAGNCGATTAAGTTTGGTACCGNCAGGTTTTTCCCAgTCAGGCGTTGGTAAACCGAcGGCCAGGGAATGTTAATCCGACTCACTAT
AGGGCCGAATTGGTNCCCGGCCCC(3')GTTGGATTCATTGGCACATGGAGATATTTTCACAAGAAAGAGGTCAGAGATAAAGTTAAGCA
GAATTTACAGGTGTGTTTGCATGTTTAGATATACTTTCGATCCTTCATAATAGTACATTCAAACTCAAAAAGTTGTTGCTACCACATCCC
AGCGCCATATAGTCCCATCTTCACAACAGCTAAGTATGGTGCTTCCATCAAAAGACATGGCAGTCTGTCTAATTGGTTGTTTAGATTGAA
CATGAGACAGCTTTGCAATCAAAGTTGGCGGGCTTGTTTGTACTTCCCAGACAAAGATCTTGCCTTCTCTATTTCCTATAGCTGCTGTTT
TGTAG

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan