ESTScan Details for Unigene SGN-U342996

Score 
-326
Direction 
Forward
Predicted Peptide Sequence 
TIHWPSFYNVVTGKTLALPNXNRLAAHPPFASWRNSEEARTDRPSQQLRSLNGEWQIVSVNILLKFALIFVKSAHXLTNRPKSAKSLINQ
KNRPDRVGVVVSSLGPRXPLLKDRGLQRQRAKNRLSGAMGHLREPXTLIKFLGFQVGRKALXSETLREPPDLELDGXSP
Predicted Coding Sequence 
ACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTXAATCGCCTTGCAGCACATCCCCCTTTC
GCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCAAATTGTAAGCGTT
AATATTTTGTTAAAATTCGCGTTAATTTTTGTTAAATCAGCTCATTNTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAA
AAGAATAGACCAGATAGGGTTGGAGTTGTTGTTTCCAGTTTGGGACCAAGAGXTCCACTATTAAAAGACCGTGGACTCCAACGTCAAAGG
GCGAAAAACCGTCTATCAGGGGCGATGGGCCACTTACGTGAACCAXTCACCCTAATCAAGTTTTTGGGGTTCCAGGTTGGCCGTAAAGCA
CTTAAXTCGGAAACCCTAAGGGAGCCCCCNGATTTAGAGCTTGACGGGGNAAGCCCX
Edits in Original Sequence 
GACCGGATTGCAGGCTTCTCTATTTTGTAGAGTTTGTTTGCGTGTCGAGTACCCCGCTGAACTGAGTGATTCTTCTTTTTAATTTATTAT
TTTTCTTTTTGGATGTTAAACAAATAATTTGCATTGATATGATCTTCAATTGTTTTAATATTGTTACATGATGATGAAGAGCTCATTTTA
TTTGGTTTTATACATTGCAATATTTGTTTTGTAACATTTGAATACAATTAATTTTAAATAAATAAATAAATTAGCCT
(5')ACAATTCAC
TGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTXAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGG
CGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCAAATTGTAAGCGTTAATATTTTG
TTAAAATTCGCGTTaAATTTTTGTTAAATCAGCTCATTNTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAG
ACCgAGATAGGGTTGGAGTTGTTGTTTCCAGTTTGGGACCAAGAGXTCCACTATTAAAAGACCGTGGACTCCAACGTCAAAGGGCGAAAA
ACCGTCTATCAGGGGCGATGGGCCACTTACGTGAACCAXTCACCCTAATCAAGTTTTTGGGGTTCCAGGTTGGCCGTAAAGCACTTAAXT
CGGAAACCCTAAGGGAGCCCCCNGATTTAGAGCTTGACGGGGNAAGCCCX(3')

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan