ESTScan Details for Unigene SGN-U343383

Score 
44
Direction 
Reverse
Predicted Peptide Sequence 
LAGQSNXKIYRLITNAKNPEPFRESSQSVLEPRSSQKPLESINNQELPIRATTLAEIRLVRA
Predicted Coding Sequence 
CTGGCCGGACAATCTAATXATAAAATTTACCGCCTAATCACCAACGCCAAAAATCCAGAACCTTTTCGAGAATCAAGCCAGTCGGTTCTT
GAACCAAGAAGTAGTCAAAAACCTTTAGAATCAATCAACAATCAAGAACTCCCAATTAGGGCCACCACACTAGCAGAAATCAGATTAGTC
CGGGCTTAA
Edits in Original Sequence 
TAATATACTGAATAATAACCAAACAACCAAATTTTTTGAAAATCTCCATATTGCACTCAGATAGCAAAGATTTTATCCCTCCCTATTAGT
TAATAGAATCTTGAAAAGCAAATACTCAACTAAGAAACTACTAATAAGGACAACTACACAAGCACGAATCCAGATTAGTCGGGCTTAATG
TATACAA
(5')CTGGCCGGACAATCTAATXATAAAATTTACCGCCTAATCACCAACGCCAAAAATCCAGAACCTTTTCGAGAATCAtAGC
CAGTCGGTTCTTGAACCAAGAAGTAGTCAAAAACCTTTAGAATCAATCAACAATCAAGAACTCCCAATTAGGGCCACCACACTAGCAGAA
ATCAGATTAGTCCGGGCTTAA(3')AAGAAACTCCTAATAAGGACAACTACACAGGCACGAATCCAGACTAGTCGGGCTTAATGTATACA
AATATTGATTCGTTCACTCAACAATTCTCTTATCGTATCGACGAATTAGAGACTTCCCAACATGAAATAACTAATAAACAAACAAACAAA
CAAA

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan