ESTScan Details for Unigene SGN-U346606

Score 
-329
Direction 
Forward
Predicted Peptide Sequence 
TIHWPSFYNVVTGKTLALPNXNRLAAHPPFASWRNSEEARTDRPSQQLRSLNGEWQIVSVNILLKFAXNFXKSAHFLTIGRNRQNPFIIK
DRPDRGGGVPVWNRVTIKDVDSTSRAK
Predicted Coding Sequence 
ACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTXAATCGCCTTGCAGCACATCCCCCTTTC
GCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCAAATTGTAAGCGTT
AATATTTTGTTAAAATTCGCGNTAAATTTTGNTAAATCAGCTCATTTTTTAACCATAGGCCGAAATCGGCAAAATCCTTTTATAATCAAA
GATAGACCAGATAGGGGTGGTGGTGTCCCAGTTTGGAACAGAGTCACTATTAAAGACGTGGACTCCACGTCAAGGGCGAAA
Edits in Original Sequence 
GGTCTCTGTGAGATCTATATGTCATGAGTTTAAACTCATACGCAAAAAGCAAAAAATATCGGCATTATGACAGACTTTCTACGTCACATG
ATAGTAGTTGGTGCGATCAGGCTATCCACCCCCTTTAATTTGCATATTTTAAAATTCCAATGTTTGTAATTGTGTGTGCTAGTATTAATT
AGTAGTTTATTAATCTAAATTTGTGTGGTTGTGTGAGAAGTTAATATAAGTGTATTATATGATGAAGATCATCATGCAAGTTTCTTTAGG
GTTTGTAAGGTTTTCAGTATTATGTATTTTATATAATAGGTTGTAATAAAGGGGTCTTTGCTTTCTTTAATTGTTCTAAATTTGTCATGA
TCCATATTTGATTTAAAAAGAGCTTTGAACAAATATTTTCCAAATATTAATTATAAAATATCCTCTTTTTCTCTTTTAAAAAA
(5')ACA
ATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTXAATCGCCTTGCAGCACATCCCCCTTTCGCC
AGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCAAATTGTAAGCGTTAAT
ATTTTGTTAAAATTCGCGNTAAAtTTTTGNTAAATCAGCTCATTTTTTAACCATAGGCCGAAATCGGCAAAATCCTTTTATAATCAAAGA
TAGACCgAGATAGGGGTGaGTGGTGTCCCAGTTTGGAACAGAGTCACTATTAAAGACGTGGACTCCACGTCAAGGGCGAAA(3')

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan