ESTScan Details for Unigene SGN-U346657

Score 
-325
Direction 
Forward
Predicted Peptide Sequence 
TIHWPSFYNVVTGKTLALPNXNRLAAHPPFASWRNSEEARTDRPSQQLRSLNGEWQIVSVNILLKFALIFVKSAHFLTNRPKSAKSLINQ
KNRPEIGLSVVPVWNKSPLLKNVDSNVKXAKNVYQGDGPLREHHPIKFFGVEVPKPKXEP
Predicted Coding Sequence 
ACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTXAATCGCCTTGCAGCACATCCCCCTTTC
GCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCAAATTGTAAGCGTT
AATATTTTGTTAAAATTCGCGTTAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAA
AAGAATAGACCXGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGXGGCG
AAAAACGTCTATCAGGGCGATGGCCCACTACGTGAACATCACCCTATCAAGTTTTTTGGGGTCGAGGTGCCTAAGCCTAAATNCGAACCC
TAA
Edits in Original Sequence 
GCCGTAACGAATATTTCTCCGGTGGAGACTGCATTGGATTTGGCTTTAACAGAAAGTGCTTTTGCACTAAGGCTTGTTAATTAATTAATT
AATTAATTAATTAGTGTCATGAAAATGACACTAAATTAATTTAATTAATTAGTTCATTAATCCATCTCTAAGTTAGTTTTGTTTTAGGCA
ATAATAAAATGTAGTAGTGTTTTTTTTCTTTTCTAAAGGGCATTATGCCCTTCAGGGTTGTAGTCTTTCTTCGAAATCTGTGTGAACATG
AGGTGTTTTGTGCATCGATTGATTAGTAATTCAAGGG
(5')ACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGG
CGTTACCCAACTTXAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAAC
AGTTGCGCAGCCTGAATGGCGAATGGCAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTaAATTTTTGTTAAATCAGCTCATTTT
TTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCXGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAG
AGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGXGGCGAAAAACGTCTATCAGGGCGATGGCCCACTACGTGAACATCACCCTATC
AAGTTTTTTGGGGTCGAGGTGCCgTAAGCCTAAATNCGAACCCTAA(3')

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan