ESTScan Details for Unigene SGN-U565045

Score 
98
Direction 
Forward
Predicted Peptide Sequence 
GKFVVFVGCALVVNLDLGFVGFDLRW
Predicted Coding Sequence 
GGAAAATTTGTGGTTTTCGTGGGTTGTGCATTGGTTGTCAACTTGGATTTAGGGTTTGTAGGATTTGATTTGCGCTGG
Edits in Original Sequence 
(5')GGAAAATTTGTGGTTTTCGTGGGTTGTGCATTGGTTGTCAACTTGGATTTAGGGTTTGTAGGATTTGATTTGCGCTGG(3')GATA
AATTGACGTTTTTGTAAGCCTTTTGTGTGGATTTATTAATTATACCTGGTTAGAAATGAGGATTAGTATATACTTTTTTGTGCTCACCTT
GTGGATTTAACAGTATTTAATGAATTCTACGAGAATAGGTTATGCGAAATCTGAGCAATTTGATATCATTCTAACCTTTGGTAAAGGAGA
GGTGATAAGTTTAGGCAACTTTTAGGCTTTCAATTTGTTGTTTGTGGAGGAAATCGTAATGAGAAGTTAGAAGTGTATGCAAACATTGAG
GTGTTAATGTATTGTTTGAGGAAGAAGTCCAGCAGAAATTGTAGGCAAAAACCTGTGCTTGAATAGATTTTCTAACTTGTAATATACTTC
TTTTTAAAAAGTAATCACTATACATCAAAGATGTTTGAGAAAAGATTTTTGGGTAAAACGAGGTGCTCTTGGAAAGTTATATTTTGGCAG
ATTGCTCATACAAGAACTAACCATTGTGCATAATTGAAAAGCCTTTCGAAAAAATTGTATTTCACACTACTAGTCGCAGCTATAACTACT
AATTGAAGCTGTGTAGCATTATGAATATGGATGCCCTCTGCTGAATTTTGGGTCCATACCATGTTCCTTTCCTGCTGTCTCTCTGTTTCT
TTCCATGGTAGAAGGTTTAAATGAGGTTCCGTCTGTGAAATTGGTTTTCTTAAGATTCCCCTGTACCCTGTCACAACTATAGAAAGTTAC
TATTCGGTTTAGTCCACAATGTGAGTGTTCTGTAATATGTTATTCTTTTCTACCTGCATAATTAGTGTTCGCATCACTAATACTTTGTTT
GTAAGTCTTGCTTGATTTAGCTTGGTTACCACTTTTATGCAACTTCATCTATAGACCAGGGGCCAGTTCTTTGTGTTAAGTAGAATTACG
TGACT

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan