ESTScan Details for Unigene SGN-U570845

Score 
121
Direction 
Reverse
Predicted Peptide Sequence 
LDATVSSTEKRLSKAVFFKIVVDQYPXDRLLYTAHRVSLDFHGQRLKLL*
Predicted Coding Sequence 
CTGGATGCTACTGTGTCCTCCACCGAGAAGCGTTTGAGCAAGGCTGTGTTTTTCAAGATAGTTGTAGACCAATATCCTGXTGATCGTCTT
CTATACACAGCCCATAGAGTTTCACTAGATTTTCATGGTCAACGTCTGAAATTACTTTGA
Edits in Original Sequence 
(5')CTGGATGCTACTGTGTCCTCCACCGAGAAGCGTTTGAGCAAGGCTGTGTTTTTCAAGATAGTTGTAGACCAATATCCTGXTGATCG
TCTTCTATACACAGCCCATAGAGTTTCACTAGATTTTCATGGTCAACGTCTGAAATTACTTTGA(3')TTTCTGTCAAGAACTCCCTGAC
ACCTTGCTTTGATTCACTTGAAAGAACCTTTATAGCAGCCATCTTTCCACTTTTTAGCCTTCCCTGTTCATAGCATCATATAGTAAAATC
CCATAAGACTTATTAAACATATAATATTCGAACCCCTAATTCATAACAAGGTAGAAGGAGAACAGTTGTCATTACCTTATAAACAGAACC
AAATCCACCCTCTCCAATTTTATTTAAAGTACTAAAATCATCTGTGGCGATTCTTAACTGCTTATAGGAGAAAAGAGTGACATTCTTGAC
GCCAGAGAGCTCTGTTGTGGATCAACTTTTTAGTATCTTTTTGACATACATAACAACTTATATGTGGTATACGAAAAGATAAAAGAATAT
TGAATGTCACAATTACTAAGAACATCCAAAAATTATATATTGGGCAGACTTTTAATGCTTACCATCATCAAATTCAGATGCATGCCTAGT
TGATGACTGATGTTTTCTATGGAACAAAGGGAAGCAAGTCATAACTTTAGGATGCACCAATGACCTTCTGTATATGATATCAACCAAAAT
CAGAGCCTCAAAAAATAGCAGAAAACAAAAGCAGGTGACCTTGCTGTTTTTTGGGTTCCTTTTCTTTTTTGAGTTTTCCAAAGAAGT

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan