ESTScan Details for Unigene SGN-U578903

Score 
112
Direction 
Reverse
Predicted Peptide Sequence 
RESWGLDKKRRSGRAXAKKRRRMLNEEREEKXKKAWGTNGINSETDPHKETQQYI*
Predicted Coding Sequence 
AGGGAATCTTGGGGTCTTGACAAGAAAAGAAGAAGTGGTCGAGCTGXTGCTAAGAAAAGAAGAAGAATGCTGAATGAGGAAAGAGAGGAG
AAAAAXAAGAAAGCGTGGGGGACAAATGGGATCAACAGTGAGACAGACCCACACAAAGAGACGCAACAATATATATAA
Edits in Original Sequence 
GAGAAACTGTATTTGAAAGACCCCAGCTCAAGTGCAGCAAATCAAGTAGTTATGGAGAGAAATGGCAGTAATGAAAATACGGCAATTAAT
AAGGAAAACAGTACAGAACATCCTGACAAGGAACAATAACAACAACAAATCAATGCTATAGCCAAAACAGAGATGGCAACATACGTCAAA
AGCAAGAAACTACATGAATGGTAACATATATCAAAATCAAGAAACTACATGAATAAGGCAAATACTAAGATAATGAACCAACCAATTCAA
GATATCATAGTACAACAACAAACGGACACTCTTTTAACATAAACAACATCCATCAGTAACCCAAGATTTAGACAACTTATTCTCTATCAA
GAACCAAGAAATCGAGTTACACTGAAAAATTGGAATTCGACAAATACCTTTTCGTCACAAGAACGGCAGAGAGCAGCCTCATCAGCAGCA
CAGAAAAGTATTGCCGCAGCACTTTCACAAACATCACAAAGGGTTCTCATATTTGTTTCTATATTTTCACTCTTCAATTTCCTTTACTCA
TTTTTCAAGAATCCACTTCAGGCCATTGATTCACTCATCATACTGTCGATTTAACAAAAACAAAGAACACCCACAAATCTGTATGAAATA
AAGTTTTAGTTTTTTTTGCCAAAGATAGAGGAAGAGTTAAAATAAAGAGACAAAA
(5')AGGGAATCTTGGGGTCTTGACAAGAAAAGAA
GAAGTGGTCGAGCTGXTGCTAAGAAAAGAAGAAGAATGCTGAATGAGGAAAGAGAGGAGAAAAAXAAGAAAGCGTGGGGGACAAATGGGA
TCAACAGTGAGACAGACCCACACAAAGAGACGCAACAATATATATAA(3')TTTGAGTCTTCAAGCTCTAATGTTCCTATTTTCTTGTCT
AAATTGCCTTTTTTATCCATTATGTTGCCAAATTAGCATGTTAAGTGGTTTGTTTTGGTTTTTGTTGTTTTGGCACGCAGATGATGTTGC
GACCAATTATCATGTTACATGGTTTTGAAATTTTC

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan