ESTScan Details for Unigene SGN-U580104

Score 
435
Direction 
Forward
Predicted Peptide Sequence 
DXPPPPYYYKSPPPPSPSPPPPYIYKSPPPPSPSPPPPYIYKSPPPPSPSPPPPYYYHSPPPPVKSPPPPYYYSSPPPPVKSPPPPAYIY
ASPPPPVHY*
Predicted Coding Sequence 
GATXCTCCTCCACCACCCTACTACTACAAGTCTCCTCCTCCACCGTCACCTTCACCACCCCCACCTTACATCTACAAGTCTCCTCCTCCA
CCATCACCTTCACCACCCCCACCCTACATCTACAAGTCTCCTCCTCCACCATCACCTTCTCCACCACCTCCCTACTACTATCACTCTCCA
CCTCCACCCGTAAAGTCTCCTCCTCCTCCTTATTACTACAGCTCGCCTCCTCCACCGGTAAAATCGCCTCCTCCCCCGGCGTACATTTAC
GCTTCACCACCACCACCAGTCCACTACTAA
Edits in Original Sequence 
(5')GATXCTCCTCCACCACCCTACTACTACAAGTCTCCTCCTCCACCGTCACCTTCACCACCCCCACCTTACATCTACAAGTCTCCTCC
TCCACCATCACCTTCACCACCCCCACCCTACATCTACAAGTCTCCTCCTCCACCATCACCTTCTCCACCACCTCCCTACTACTATCACTC
TCCACCTCCACCCGTAAAGTCTCCTCCTCCTCCTTATTACTACAGCTCGCCTCCTCCACCGGTAAAATCGCCTCCTCCCCCGGCGTACAT
TTACGCTTCACCACCACCACCAGTCCACTACTAA(3')AAGTTTCTAAGAGTGCAGTCATTCTCCACAATCAATCAAATTTTAGTTTGAA
ACACAAAATAAATGATGGCTTCTTGAGGAATAGATTCAAACGTCAATGGTTCAAAGCAATTAATTTATGGAATAACATTTTCAATCTTTT
AATTGAAGGGTTGATTCTTCATGACATGGACATATTTGATTCTACTTCTCTTTTGTCCTTCTTGCACATTGTTCTCTTAGTGCGTTCACA
TGAACGTATCTAGGCTTTGATGCTTCTTAGAGTTTGTTTCTTTGTAACTTATTATTTGTATTGAGGATATTGTCCTCTTTTATTCATTCT
TATTAATTATTACTGAATGTTGTTCTCGTAACACCTTTATGTACTTTGTGCATTAATCAATAAGAAGATCAATTTTATT

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan