ESTScan Details for Unigene SGN-U581633

Score 
186
Direction 
Forward
Predicted Peptide Sequence 
MAQSIRFFATLFLLAMLVMATEMGPTRIVEARHCESLSHRFKGPCVRIRIVPRFARPKDFPVVIAVDSVAVAFAPSHAK*
Predicted Coding Sequence 
ATGGCACAATCCATTCGTTTCTTTGCTACTTTGTTTCTTCTAGCCATGCTTGTTATGGCTACTGAAATGGGACCAACGAGAATCGTAGAG
GCAAGACATTGTGAGTCGTTGAGCCATCGTTTCAAGGGACCATGTGTGAGGATAAGAATTGTGCCTCGGTTTGCGAGACCGAAAGATTTT
CCGGTGGTAATTGCCGTGGATTCCGTCGCCGTTGCTTTTGCACCAAGCCATGCTAAATAA
Edits in Original Sequence 
TAGGGCGATTGGCGGCCAATCGGCCGAATTCCCATGGGGATCCATTGACATTACATTAAAAAAAATAAATTATTATTTCTTCTCTCTCTC
AAAAAAATTGTGAAA
(5')ATGGCACAATCCATTCGTTTCTTTGCTACTTTGTTTCTTCTAGCCATGCTTGTTATGGCTACTGAAATGGG
ACCAACGAGAATCGTAGAGGCAAGACATTGTGAGTCGTTGAGCCATCGTTTCAAGGGACCATGTGTGAGcGATAAGAATTGTGCCTCGGT
TTGCGAGACCGAAAGATTTTCCGGTGGTAATTGCCGTGGATTCCGTCGCCGTTGCTTTTGCACCAAGCCATGCTAAATAA(3')ATAATT
TTGATTTTTATGTGTAAAAGAAGAAGTTTGAGAAGAAAAAAAATATTATGTAATTTTGAATAAAGATGTATTGTAATGCTAGTTTTGTTT
GTAAAAACTAGTTGTGATCTTTGAATTTGTATGCAATTATGGTGCACTAGACTTGTAATTCTTCATGTGGTGTATTTTTATTTTTATTTT
TGAAATATTATAGATAAAATTTGTCTTTTAGCCTTTTTGTTAGTAAGTTTTAATAAAATATTCTTCGATGCGGAATCAAGAATCGATCAT
TTCTTTT

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan