ESTScan Details for Unigene SGN-U589310

Score 
9
Direction 
Reverse
Predicted Peptide Sequence 
ASWGDYSIEGSLDSFXMSQKPLKVIYGGIQKPYPRNSL*
Predicted Coding Sequence 
GCATCATGGGGCGATTATTCCATCGAAGGCTCCTTGGACTCGTTTGAXATGTCGCAGAAGCCCCTCAAAGTCATATATGGAGGAATTCAA
AAGCCATACCCCCGCAATTCGTTATGA
Edits in Original Sequence 
(5')GCATCATGGGGCGATTATTCCATCGAAGGCTCCTTGGACTCGTTTGAXATGTCGCAGAAGCCCCTCAAAGTCATATATGGAGGAAT
TCAAAAGCCATACCCCCGCAATTCGTTATGA(3')TTCCATTTGTATTTTTAACCCCCCTGAAAAAAAGTGGTCAGTTTGCCTGACGGAT
TTTGAGCCTGACGCAAAAATAAACCATTTTTCATGTGGCCATGTTTTCCCCAAGCATTGTTTAAAAAAGTGGGTCAAGGACTGGAAAGTA
ACTTGTCCCCTTTGCAGGAATTACATGATGTTTCAAAAAGGGGAAAAAAAAACTTGTCCTATGTGAGGTTAAAAGTTTATCGAGGGTATA
GCCCTACTATACATTTTGAGGACAGCTTAGTAGGGGACAAGCAAAGGTTGATTTTTGACATTGGGGAGTTTTGTATTTGTAAAGCTTGGG
GTCCTTTCAAAATGACGGGTTTTTTTTCTGCGACCAAAAATTCATACATTTGGGGACATAAAATATGGAAAATTTTGGTTTGATGTTTTC
CCTCCC

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan