ESTScan Details for Unigene SGN-U591878

Score 
290
Direction 
Reverse
Predicted Peptide Sequence 
MANQGEWPISAAMKDPTPSFLFFGILVPALLPPAASFGAFFAAFSAELSHPFHGAAQESNHHQLPSCFYQHELQLFPDPFPSDFRESWKG
VEWVGGA
Predicted Coding Sequence 
ATGGCCAACCAAGGGGAATGGCCAATTTCTGCTGCCATGAAGGACCCCACCCCTAGCTTTTTATTTTTTGGGATCCTTGTTCCAGCATTG
CTACCTCCGGCAGCCTCTTTTGGTGCTTTCTTTGCAGCCTTCTCTGCAGAGCTTTCGCATCCCTTTCACGGCGCTGCTCAGGAGTCAAAC
CATCATCAGCTCCCTTCTTGCTTTTACCAGCACGAGCTGCAGCTCTTTCCCGATCCTTTTCCCTCTGATTTCCGCGAGTCATGGAAAGGA
GTTGAATGGGTCGGTGGAGCX
Edits in Original Sequence 
TTCAGACGTATTAAGTTGTAGTGCATCACAAGATTTAAACAGTGAATAAC(5')ATGGCCAACCAAGGGGAATGGCCAATTTCTgGCTGC
CATGAAGGACCCCACCCCTAGCTTTTTATTTTTTGGGATCCTTaGTTCCAGCATTGCTACCTCCGGCAGCCTCTTTTGGTGCTTTCTTTG
CAGCCTTCTCtTGCAGAGCTTTCGCATCCCTTTCACGGCGCTGCTCAGGAGTCAAACCATCATCAGCTCCCTTCTTGCTTTTACCAGCAC
GAGCTGCAGCTCTTTCCCGATCCTTTTCCCTCTGATTTCCGCGAGTCATGGtAAAGGAGTTGAATGGGTCGGTGGAGCX(3')

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan