ESTScan Details for Unigene SGN-U593067

Score 
497
Direction 
Forward
Predicted Peptide Sequence 
MAASTQCFLHQYHALRSSPARTSSVSSPKPNQLICRAQKQDDASNAVSRRLALTLLIGTAAIGSKVSPADAAYGEAANVFGKPKENTDFL
PYNG
Predicted Coding Sequence 
ATGGCTGCTTCCACACAATGTTTCTTGCACCAATATCATGCACTAAGATCTAGCCCTGCTAGAACCTCCTCTGTTTCATCTCCTAAGCCT
AACCAATTGATTTGCCGTGCACAAAAGCAAGATGATGCCAGCAACGCCGTGTCGAGACGATTGGCTCTTACTCTCCTCATTGGTACTGCT
GCCATTGGTTCCAAGGTTTCCCCTGCAGATGCTGCCTATGGAGAAGCTGCAAATGTTTTTGGGAAGCCAAAGGAAAACACTGATTTCTTG
CCATACAATGGA
Edits in Original Sequence 
AACACTTTATTTGTTCAAAAGTCATTCCTATTAGACACAAAATGCTGACATAGCAAAAAACATGTAATTCACTTTCCTTGAGCGCGTTAA
TTTATTAAAAATAATATTTTTCTTTTTTTTTTTCTTAATTTATACCCCTAAGTTAATTTTTTAAAAAATAATTAACAAAAAAGAAGAAGA
ACAATTGTATTCTTCTTCCCTATTTCTATCAACCCCACCCCACCCCACCCCAACCCCCATACCCATGCACCAGTGGTTATCTTCTTCCCC
CACCATTCTAATGATTTCAAAATTCTTAGCATCAGTGGTTATCTTCTTCCCCCTCCAACATCACCATTGTAACAAAGAATTGGAATCGAA
TTCCAAAACCAAGCAAAGAGAGCA
(5')ATGGCTGCTTCCACACAATGTTTCTTGCACCAATATCATGCACTAAGATCTAGCCCTGCTAG
AACCTCCTCTGTTTCATCTCCTAAGCCTAACCAATTGATTTGCCGTGCACAAAAGCAAGATGATGCCAGCAACGCCGTGTCGAGACGATT
GGCTCTTACTCTCCTCATTGGTACTGCTGCCATTGGTTCCAAGGTTTCCCCTGCAGATGCTGCCTATGGAGAAGCTGCAAATGTTTTTGG
GAAGCCAAAGGAAAACACTGATTTCTTGCCATACAATGGA(3')

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan