ESTScan Details for Unigene SGN-U598280

Score 
20
Direction 
Forward
Predicted Peptide Sequence 
MGPFIHYIIKIWHFNILRAXVTNKTDALHFTNIVKSDXNRPIPKGNPSFPPAPHPKPGFPRAPKLGQLPHGP
Predicted Coding Sequence 
ATGGGGCCATTTATACATTACATAATTAAAATTTGGCATTTTAATATCCTTCGCGCTXTTGTAACCAATAAAACTGACGCCCTGCACTTT
ACAAACATTGTCAAATCCGATAAXAACCGACCCATCCCGAAGGGTAACCCTTCTTTCCCTCCCGCCCCTCACCCAAAACCTGGGTTCCCC
CGTGCCCCCAAACTTGGGCAACTTCCACATGGTCCX
Edits in Original Sequence 
AAATAAAACAAATGCCATTTATTCAAAAAATGAAGGGAACCCAACAAACTAAAATTACTACACTTTCTCCAAAAAAAAACTTTAAGGAGG
ATTCCAACAACCTTCCCCCAAAAAC
(5')ATGGGGCCATTTATACATTACATAATTAAAATTTGGCATTTTAATATCCTTCGCGCTXTTG
TAACCAATAAAACTGACGCCCTGCACTTTACAAACATTGTCAAATCCGATAAXAACCGACCCATCCCGAAGGGTAACCCTTCTTTCCCTC
CCGCCCCTCACCCAAAACCTGGGTTCCCCCgGTGCCCCCAAACTTGGGCAACTTCCACATGGTCCX(3')

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan