ESTScan Details for Unigene SGN-U602682

Score 
27
Direction 
Forward
Predicted Peptide Sequence 
XQDSMVFGQRIEQALKXLKRDGTGGTNKHS*
Predicted Coding Sequence 
XXTCAAGACTCTATGGTGTTCGGTCAGCGAATAGAACAAGCACTTAAGGAXCTCAAGAGAGATGGAACTGGAGGAACTAACAAGCACTCA
TAA
Edits in Original Sequence 
(5')XXTCAAGACTCTATGGTGTTCGGTCAGCGAATAGAACAAGCACTTAAGGAXCTCAAGAGAGATGGAACTGGAGGAACTAACAAGCA
CTCATAA(3')TACTCAAATAAATAAGTTCCTATCAATATCTGCTTCTCACAACATAAACTTTCATGAACATAAGTTATAAAAATTTGAT
CTTTAAATAACCAAGTCAATTGAATCAAATACATCCTAATTTATATAAAGATCAAACCTAGGGTTAAGGGTCATCATCTACAAGCTAGAC
CAACCCATCAATATATATCATAATTGAGTTAAAATTCATGTAAATATACTCATATTATACAATATAAAAC

ACTGX -- Inserted by ESTScan
actgn -- Deleted by ESTScan
ACTGN -- UTR Deleted by ESTScan