Unigene SGN-U106724

Unigene Basic Information 
Unigene ID: SGN-U106724
Unigene Build: Lycopersicon esculentum demethylated #1
Date: 2002-12-20
Organism: S.lycopersicum
Alternative ID: 106724
mRNA sequence: Length: 646 bp

>SGN-U106724 Lycopersicon esculentum demethylated #1 (3 members)
AAACAACACGCTCACAATCACAAATAGAATAAATAACAACCATCTCACTCTCACGAGAATTAACATGAGATCCAACTAGTTCTAGAACAA
GGTCGTGGCCTGACATACCTCAACCAATTCAACATATATAACAAGAGAAAGGAAACCACTCTAAGCAAGCAGCGAAAAGAAGTACAACCC
AAGAAATACCTCCTCCACTCGAAGACACCACCAAAAAGAGGTACAAACACAACTAACCCCCACCTACGACAAACATAAATATCGAAGGTT
CCAAAACTAACCAATGGATATGAACCTCATCATAGGTACAATTTTAATTGAAGCAAAACCCCACAACCTACACAATCTTACAGTATCCGC
ACTAGCAGAAAGAACCAAACTCGAGAACCACTCCCAAGAAGCTATAATATCGGAGGATAAATTGAAACTCATTCTAAGGCATTAGTCGCA
CCAACTACTAACAAGGTACGAAATTACGACTTTAAAAACATTAAAAATACAAAGCTAAGAGACAGGCAAATAATCTCCAACCTAAACTAA
GGATTTCATAATTCTCACTATTCTAAGGTTCAAGCGGGAATCAAGGAAATAAGGATAATAGAGATAATCCTAAATCTGCTACACACAATC
AAAGAACAAGTAGATC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (3)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None