Unigene SGN-U112717

Unigene Basic Information 
Unigene ID: SGN-U112717
Unigene Build: Lycopersicon esculentum demethylated #1
Date: 2002-12-20
Organism: S.lycopersicum
Alternative ID: 112717
mRNA sequence: Length: 544 bp

>SGN-U112717 Lycopersicon esculentum demethylated #1 (1 members)
AGGTAGGTGATCAAGTCTACCTGAATATATCAACCATGAAAAAGGGATGATGAGGTTTGATAAGAAAAGGAACTTGAGTCCTAGGTATAT
AGGTCCTTATGAGGTCTTACAACGAGTAGGGAATGTTGCCTATGAAATGAAGGTACCAAGTGACTTGGCTTCTGTTCATCCAGTGTTTTA
TGTTTCAATGCTTAAGAAGTGTTTGGGTGATCCAGCATTCGTCCTTCCTGTTGAGGGGTTCAGAGTCGATGAGAACCTTTCTCATAAAGA
GGTTCCAGCTTAAATTTTAGATCTCCAAGTGAGCAACAGAGGAACTAGGAGGTTGCCACCGTAAAGTTGTTATAGAGGAACCACCTTGTT
GAGGGAGCAACATGGGAGGCTGAGGACGACATGAGATCCCGTTACCCTCACTTGTTCAGTTCTTAAGGTTAGATATACTATTTCTTAGTC
TGATTTTGTTTATGAAACTCTAAATTTTAGTGCATTAGTCAGTGTTGGTGTTTTAAGTCCATAACTGTGTGTTTTATACTTGGACTATAT
GAGT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E53931
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None