Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U198999

Unigene Basic Information 
Unigene ID: SGN-U198999
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 198999
mRNA sequence: Length: 598 bp

>SGN-U198999 Capsicum annuum #1 (1 members)
CGAGTTTTTTTTTTTTTTTTTAGAAATTAATTTCAGATTAAAGGAAGTTGAGCATCCAAAACTCAAAACGCATAATTCACAATTGTCGAA
CTTAATGATATACTACATTTTAGCATGAACAAGCCCTAAACAAGAACCTCGTGTCTCGAGTTTTTTTTTTTTTTTTTTTAGCAAAGAAAC
AAATGATTATTATTATTAGTTCTCATAAACTCAACTGGAATCCAAGAGCATACACTGAATAGAGAAAAGGAAAACAATGGAAAATCAATA
CAGTTTCTCCAGGGAAAAACTTGAGGAGGATTCAAACGAGCTTCCCTTAAAGACATAGGGCCAGGTTATACATTAAACATGGATAATTTA
GTAGCCTTCGGGCTTGTAGGCGATGAAACTGATACACTGCACTTGACGAACGTTGTCGAATCCGATGATACGGATCCAGGCCTGTGGGTA
AGCCTTCTTTGCCTCCTGGACTTCATTCAAGACCTGGGTAGCATCAGTACACCCGAACATGGGCAACTTCCACATGGTCCAGTACCTGCC
ATCGTAGTATCCAGGTGACCTGTGGTGCTCACGGTACACAAATCCGTGCTCAGTCTCG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
AF065615 ribulose 1,5-bisphosphate carboxylase/oxygenase small subunit
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None