Notice: SGN will be briefly unavailable for maintenance. Apologies.

Unigene SGN-U199851

Unigene Basic Information 
Unigene ID: SGN-U199851
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 199851
mRNA sequence: Length: 598 bp

>SGN-U199851 Capsicum annuum #1 (1 members)
TGCNGCGGTGGAAATTGTTATGCTGAATATGAGATGGTTGAGATCCCAAAAAAATAAATGCGAGTGTGTTTTGACTGCCAACAGTGTTGC
GCGAGGGCAGTACGTGTCAGAGCTTCTGCAATTTTGAGTACTTCTAATCCTTTTACATAGAATTTACAAAAATGTCTCTCCCAAGAAGTT
CATTTGCAGAAAGCTGCTGGATTTGGTCCACAATGGTATGAACCTCTAGCTGTTAAAGATTCCACAGCACTATGAAGGCGTCTCTCACTG
GTTGGAGGTAGCAGGTACCTGGTGAAATTAATTAAGGTGTGCACGGGCTGACCGACACTACGATGCTTATCGAGCCAAATTGCCTATTGA
TGATGGAATTGTCTTTCTTTCTAAAGTGAAAGCGATGCTACAAAATGTGAAGTCACAAACTTGTTATTTGGTTATTTGGTTAGCTATTGT
ATACTTATTTGGTTAGCTGGTCTTACAAAAGGGATAACATCATAACAAAAATTATTTGGATCCTTCTTGTCATTGAAATTTGATTAGCTG
TTATTTTTACAGAGAATAACTATTATTCATAAAAAAAAAAAAAAAAAAAAAAAAACTC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E494016
[Show Image]
Markers Information (1)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (4)  
Preceding Unigenes (0)None