Sol Genomics Network

Unigene SGN-U201146

Unigene Basic Information

Unigene ID:	SGN-U201146
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	201146
mRNA sequence:	Length: 424 bp

>SGN-U201146 Capsicum annuum #1 (1 members)
GGACTTACGATGAGCGGCTGGAAACACTGAAGCATGTACGAGAAGCAGGAATTAATGTGTGTTCAGGTGGAATAATAGGGCTTGGTGAGG
CAGAAGAGGATAGAATTGGTTTGCTGCATACCCTGGCCACTCTTCCGACTCACCCTGAGAGTGTGCCGATTAATGCACTTATTGCAGTAA
AAGGCACGCCATTGGAAGACCAGAAGCCAGTGGACATATGGGATATGATTCGGATGATTTCGACAGCCAGAATAACAATGCCAAGCGCAA
TGGTTAGGCTTTCTGCAGGAAGAGTTCGGTTTTCTGTCCCGGAGCAGGCTCTTTGTTTCCTTGCTGGTGCGAACTCCATCTTTACAGGTG
AGAAGTTGTTGACTACACCCAATAATGACTTCGATGCTGATCAGAATATGTTCAAATTACTTGG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS12	Placenta	4279	1

mRNA member sequences (1)

To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]

Markers Information (1)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	2891	Biotin_synth Cons_hypoth1212 Radical_SAM	6
2	25580	Biotin_synth Cons_hypoth1212 Radical_SAM	6
5	59578	Biotin_synth Cons_hypoth1212 Radical_SAM	6
1.1	103881	Biotin and thiamin synthesis associated - Molecular Function: biotin synthase activity (GO:0004076) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: biotin biosynthesis (GO:0009102) Elongator protein 3/MiaB/NifB Radical SAM - Molecular Function: catalytic activity (GO:0003824) - Molecular Function: iron ion binding (GO:0005506) Biotin synthase - Molecular Function: biotin synthase activity (GO:0004076) - Biological Process: biotin biosynthesis (GO:0009102)	5
2	122373	Biotin synthase - Molecular Function: biotin synthase activity (GO:0004076) - Biological Process: biotin biosynthesis (GO:0009102) Radical SAM - Molecular Function: catalytic activity (GO:0003824) - Molecular Function: iron ion binding (GO:0005506) Biotin and thiamin synthesis associated - Molecular Function: biotin synthase activity (GO:0004076) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: biotin biosynthesis (GO:0009102) Elongator protein 3/MiaB/NifB	5
5	132567	Biotin synthase - Molecular Function: biotin synthase activity (GO:0004076) - Biological Process: biotin biosynthesis (GO:0009102) Radical SAM - Molecular Function: catalytic activity (GO:0003824) - Molecular Function: iron ion binding (GO:0005506) Biotin and thiamin synthesis associated - Molecular Function: biotin synthase activity (GO:0004076) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: biotin biosynthesis (GO:0009102) Elongator protein 3/MiaB/NifB	5

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer