Unigene SGN-U202588

Unigene Basic Information 
Unigene ID: SGN-U202588
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 202588
mRNA sequence: Length: 629 bp

>SGN-U202588 Capsicum annuum #1 (1 members)
ATGAAGTTGTGCTGATCACCTGCCGCCTTATGAATCCAGACCTAGACTTGGTCAATGGAGCCGTTAAAGAAAAGCTTGAGAATTTCTGCA
ATGAGCTATATGAAATGAGATTTAACATGAAGAGTGGTGCAGCTTCACAGAAGAAACTATCGGAGTCTGCTGTTGATTTTCCAAGGATCA
ATGAGAACTACACTGGCAGGAAGCAGCGTTATGTATATGGAACCACTTTGAACAGCATTGCTAAGGTAACTGGAATCATCAAATTTGATT
TGCATGCTGAACCAAAGACTGGAAAATCACAGCTTGAAGTTGGAGGAAATGTTCAAGGCATATTTGATCTTGGACCTGGCAGATTTGGTT
CGGAGGCTGTATTTGTTCCTACTCAGCCTGATACAGAATGTGAAGAGGACGATGGCTTCTTGATATTCTTTGTACATGATGAGAACACTG
GAAAGTCAGCTGTGAATGTAATTGATGCAAAAACAATGTCCGCGGAGCCTGTGGCACTAGTTGAATTGCCAAAAAGAGTTCCTTATGGAT
TCCATGCTTTCTTTGTCCCAGAGGAACAAATTCTGGAACAAGCCAAACTGTGATGGTGATCAGCGACCTATACACCCCGATATGCCATA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Y14164 dioxygenase Y14164dioxygenase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E509772
[Show Image]
Markers Information (1)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None