Unigene SGN-U205211

Unigene Basic Information 
Unigene ID: SGN-U205211
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 205211
mRNA sequence: Length: 545 bp

>SGN-U205211 Capsicum annuum #1 (1 members)
CTGATTCTTTGGTATGGTGCACACCTTGTTAACAATGGGGTCTCGACTTTCTCTAAGGTGATTAAGGTCTTTGTAGTCCTTGTGGTCACA
GCTAATTCAGTTGCTGAAACTGTCAGCCTAGCACCCGAGATTATTAGGGGTGGTGAAGCTGTTGGTTCTGTATTTTCCATTCTTGATCGC
TCTACTAGGATCGATCCTGATGACCCTGAAGGTGATCCAGTCGAATCAATTAGAGGGGATATTGAACTCCGTCATGTTGATTTTTCGTAC
CCTTCACGACCGGATGTCTCTGTGTTCAAGGACCTCAATCTAAGGATTCGTGCTGGCCAAAGCCAAGCTCTTGTGGGGGCAAGTGGCTCG
GGAAAGAGTTCCGTTATAGGCTTAATCGAAAGGTTCTACGATCCAACAGGCGGAAAAGTTATGATCGATGGGAAAGACATAAGGAGATTA
AACTTGAAGTCTCTAAGGCTTAAAATTGGTTTGGTGCAACAAGAGCCAGCTCTGTTTGCAGCTAGCATTTTTGATAATATTGCCTATGGT
AAAGA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None