Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

Unigene SGN-U205417

Unigene Basic Information 
Unigene ID: SGN-U205417
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 205417
mRNA sequence: Length: 687 bp

>SGN-U205417 Capsicum annuum #1 (1 members)
TCCAACGGTCAGTTCTGCCTTTCCCTCTGTGTGATATTAATTTTGACTTACACAGTAGATATCAGCTTCGTTTCAGGAAAAAAAGAATTT
ATTTGATGCCGATTTTCGTCGTGATTTGTTAAATAATGGGAGCGCTGGGAGTGCAGGCTTTAACTTTCCACAAATGCAACAACCTGAAAG
TCAGGAACATAAAGCTCCTTAATAGTCAACAAATGCATTTAGTGTTTACTGATTGCAAGCATGTTGCAGTATCAAAGCTCGTAATCTTAG
CCCCAGCTGATAGCCCTAACACTGATGCAATTCATATAAGTTCATGTACAAAGGTCAATGTCAAGGATTGCACTATTGGCACAGGAGATG
ACTGCATATCTATTGTCGGCAATTCATCACGGATCAAAGTCAACAACATTGTCTGTGCTCCGGGCCATGGTATAAGCATTGGAAGCTTGG
GCAAGTCAAATTCATGGGGTCAGGTTTACAATGTCCATGTTAATGGAGCATTTATATCCAACACTGAGAATGGAGTTAGGATAAAGACTT
GGCAGGGAGGTTCTGGGTATGTCAGAAAGGTTACTTTCAAGAATGTCTGGATGGAAAATGTGTCAAACCCTATCATTATAGACCAATATT
ATTGTGATTCTATGGAACCCTGTGCAAACCAGACTTCAAACATTGGCATTGACAAGG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
ppg1 endopolygalacturonaseendopolygalacturonase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E494428
[Show Image]
Markers Information (1)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None