Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U207106

Unigene Basic Information 
Unigene ID: SGN-U207106
Unigene Build: Solanum melongena #2
Date: 2004-01-12
Organism: S.melongena
Alternative ID: 207106
mRNA sequence: Length: 263 bp

>SGN-U207106 Solanum melongena #2 (1 members)
GCTTTTTGCAAAGAAAGAGATGCGCATACTGATGGTGGGTCTTGATGCTGCTGGTAAAACAACCATTTTGTACAAACTCAAACTGGGAGA
GATAGTCACCACCATCCCCACCATTGGCTTCAATGTGGAGACCGAGGAATATAAGAACATTAGCTGTACAGTTTGGGATGTCGGAGGTCA
GGATAAGATTCGTCCTTTGTGGAGACACTACTTCCAGAACACCCAGGGACTCATCTTTGTTGTTGATAGCAATGACAGAGATC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 5 )  
Protein prediction analysis (3)  
Gene Family (6)  
Preceding Unigenes (0)None