Unigene SGN-U209170

Unigene Basic Information 
Unigene ID: SGN-U209170
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 209170
mRNA sequence: Length: 375 bp

>SGN-U209170 Petunia hybrida #1 (1 members)
GAGGCTGTATGGTTCAAGTGGTCACAAATTTTCAGTGAGGGTGGACTTGACTACTGGGCAACCAAGTTTGGTCCACGCACAAAGCATCTT
GGCCATCTGGGGCTTGCCAAGTTGTGTTGATGGGAGCCGTTGAGGGTTACCGTGTTGCTGGTGGACCTCTTGGTGAGGTTGTCGACCCAC
TTTACCCCGGTGGCAGCTTCGACCCATTGGGCCTTGCCGAGGATCCAGAGGCTTTTGCTGAACTCAAGGTGAAGGAAATCAAGAATGGCA
GACTTGCTATGTTCTCCATGTTTGGATTCTTTGTTCAAGCTANTCGTCACCGGAAAGGGCCCATTGGAAAACCTTGCTGACCACCTTGCA
GACCCGGTCAATAAC


[Blast] [AA Translation]
Associated Loci (6)  
Locus symbolLocus nameGene activity
PETCAB146 chlorophyll a/b binding protein 146chlorophyll a/b binding protein
PETCAB102 chlorophyll a/b binding protein 102chlorophyll a/b binding protein
PETCAB10 chlorophyll a/b binding protein 10chlorophyll a/b binding protein
PETCAB4 chlorophyll a/b binding protein 4chlorophyll a/b binding protein
PETCAB3 chlorophyll a/b binding protein 3chlorophyll a/b binding protein
Cab chlorophyll a/b binding proteinchlorophyll a/b binding
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None