Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U209999

Unigene Basic Information 
Unigene ID: SGN-U209999
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 209999
mRNA sequence: Length: 662 bp

>SGN-U209999 Petunia hybrida #1 (1 members)
TACAAACCCATTATCAATGGGCGAAGAAGGTTTAGAGCATGAAAGAATGGTGAAGAAGAGGAGCAGTGGCCACTCATTCAATACGATGTT
CCCCCTTATCGAACTTATCATTTCTTCAGTCAATTCAGAACTCCTTGTAACCCTAACAACTTTTTAAAGGCTGTCAAATGGTCCCCCGAT
GGTTCTTGCTTTCTCACTTGCTCTGATGCTAACACCTTTTCTTTATTTACCTTACCATATGATGAGAATGGATGGCTTGCTGATACTTCT
TCATCAGCTGCTGATACAGATTCTTATGCTGCAAGCCTTGTCATGAGTGATGGGGAGTCTGTATATGATTATTGCTGGTATCCCTATATG
TCTTCTTCAAGTCCAGAGACATGTGTTTTTGCAAGTACTACCCGTGATCACCCTATTCATCTGTGGGACGCTACTACTGGAAAGTTACGG
TGTACCTACCGTGCTTATGATGCCATGGATGAGATAACTGCTGCCTTTTCAATTGCTTTCAACCCTGCAGGAACTAAGATATTTGCTGGG
TACAACAAATCCATAAGAATATTTGATATTCATCGGCCTGGTAGAGATTTTACCCAGCACTCCACCCTTAAAGGAAATAAAGAAGGGCAA
TCAGGAATCATATCCTCAATTGCTTTCAGTCC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None