Unigene SGN-U210177

Unigene Basic Information 
Unigene ID: SGN-U210177
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 210177
mRNA sequence: Length: 522 bp

>SGN-U210177 Petunia hybrida #1 (1 members)
AGGATTATTGGTGTTGATTTGAATCCTAGCAGATTCAATGATGCCAAGAAGTTTGGAGTCACCGAGTTTGTGAATCCAAAAGATCATGGT
GATAAGCCTGTCCAGCAGGTAATTGCTGAGATGACCGATGGAGGTGTTGATCGGAGTGTCGAGTGCACTGGAAATGTCAATGCCATGATC
TCTGCTTTTGAATGTGTTCATGATGGTTGGGGTGTGGCTGTGCTTGTTGGTGTTCCAAACAAAGATGACGCATTCAAAACTCATCCCATG
AATCTTTTGAATGAGAGGACTCTGAAGGGCACCTTCTTTGGCAATTACAAGCCCAAATCTGACATTCCATCTGTGGTGGACAAGTATATG
AAAAAGGAACTAGAGCTGGAGAAATTCATTACTCACCAAGTTCCATTTTCGGGGATCCACCAAGGATTTTGTTTATTTGCTGAAAGGGGG
AAAGTATTCGTTGCATGATTACTATGGAACATTGAATCGTTGATGAATAGGAGGACAAAGACTCGTGGGTGT


[Blast] [AA Translation]
Associated Loci (3)  
Locus symbolLocus nameGene activity
adh3 alcohol dehydrogenase 3alcohol dehydrogenase
Adh2 alcohol dehydrogenasealcohol dehydrogenase
ADH1 alcohol dehydrogenase 1alcohol dehydrogenase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None