Sol Genomics Network

Unigene SGN-U210318

Unigene Basic Information

Unigene ID:	SGN-U210318
Unigene Build:	Petunia hybrida #1
Date:	2004-03-30
Organism:	P.hybrida
Alternative ID:	210318
mRNA sequence:	Length: 422 bp

>SGN-U210318 Petunia hybrida #1 (1 members)
GTTTTTTTTTTTTTTTTTTTTTTTTTGAGTTCAACTTAATAATGTATNGATGGATAAAGAAACATCATCTTGGCAAGTGTGCCAAAAAAA
CACGTCCTTAGAACACAAACCAAAATTTAAAGTACTAACATTTCATAATTAAAAATCTACTAAAGGCAAAACAACCGAAGAGCAACATCT
AATCCAGGCCTCAAGCCTCAACCCTCTCAGGTGCAGCCTCCTCAGCGGTGTGGACAATAACCTTATGGGCAGGTTTAGCCAAGATATCAA
AGTACTCTTGGAATGGAGATTGGGTGAAGCGAGTCTCCTTCCAGAAGTCTGGAGTAAGGAACCCATATGTCTTCATCAAACAATCAAAGG
TAGCCTTAACGAAGTTTCCAAGCGTCTTGGTGGATCCACGAGAAGAAGTAAACACATCCTCA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Petunia x hybrida	Petunia-C2H4	all floral organs anthesis	3072	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E526249
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	568	Ribosomal_S5_C Ribosomal_S5_e/a Ribosomal_S5_b/o Ribosomal_S5	32
2	22810	Ribosomal_S5_C Ribosomal_S5_e/a Ribosomal_S5_b/o Ribosomal_S5	19
5	57011	Ribosomal_S5_C Ribosomal_S5_e/a Ribosomal_S5_b/o Ribosomal_S5	18
1.1	101816	Ribosomal protein S5 C-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein S5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	35
2	119039	Ribosomal protein S5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein S5 C-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein S5 eukaryotic and archaeal form - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935)	22
5	129407	Ribosomal protein S5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein S5 C-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein S5 eukaryotic and archaeal form - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935)	22

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer