Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U579915 and SGN-U590592 in the current build, Tomato 200607 #2
Unigene SGN-U212737

Unigene Basic Information 
Unigene ID: SGN-U212737
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 212737
mRNA sequence: Length: 1006 bp

>SGN-U212737 Lycopersicon Combined #3 (44 members)
AATAGTCTGGGCGCATTAGGGTAGATCCCAGATCTGGTGGAAGAGGAATAAAACTGAGATCGGGATCCCCATACCTATCGGCAAACAAAA
GAAGGATGTTTCTCTTCGATTGGTTCTATGGCGTTTTGGCTTCTCTAGGGTTATGGCAGAAGGAAGCTAAGATCCTCTTTCTCGGCCTTG
ATAATGCCGGAAAGACTACTCTTCTTCACATGCTTAAAGACGAGAGATTAGTTCAGCATCAGCCGACTCAGTATCCGACATCGGAAGAGC
TTAGTATTGGAAAAATCAAATTCAAAGCGTTTGATTTAGGAGGTCATCAGATCGCTCGCCGTGTTTGGAAGGATTACTATGCTAAGGTTG
ATGCTGTTGTATACCTGGTAGATGCTTATGACAAAGAGCGCTTCGCTGAGTCAAAGAAAGAATTAGACGCACTGCTATCTGATGAGTCCC
TAGCGACTGTTCCCTTCCTCATTTTGGGAAACAAGATAGACATACCGTATGCTGCCTCAGAAGATGAGTTGCGTTATCACCTTGGGTTGA
CTGGTGTCACTACTGGCAAGGGTAAGGTGAATCTAGCTGATTCTAGTGTTCGTCCCTTGGAGGTGTTTATGTGCAGTATTGTACGCAAAA
TGGGTTATGGTGATGGCTTTAAGTGGGTTTCGCAATATATCAAGTAGTTTATATCATTTGCATATGTACCAGAAGTTGAAACAGAAATTG
TCCTCTTTTATGCTTTCGTACAACTATTTTTTCCCGTCTGGAAAAGATGGAATCTGTTCATTTGTTCTCAAACTGATGAGGTCTTTAGTA
CTTATAAATTGTATGCATCGAGCATCTATTTAGCGTGATGAGAAGCTATATTTATTGTTGGTGTAAAATTTAACTATGGCTGGAAAATTG
TCAAACTCCAGATTATTGGCTTCCAACTCTTAGGACCCATACTTCTCCGCCTCTTCTTAAGCAATTTTCTGCGTGAGAATAGTTTCTATC
TGTGTTGAACTTTAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (17)  
mRNA member sequences (44)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (3)  
Annotations (manual: 3 | blast: 2 | go: 6 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)