This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U579141 and SGN-U580248 in the current build, Tomato 200607 #2
Unigene SGN-U212772

Unigene Basic Information 
Unigene ID: SGN-U212772
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 212772
mRNA sequence: Length: 824 bp

>SGN-U212772 Lycopersicon Combined #3 (36 members)
CTCAGGTTTCTCTCTCAATAGATCCCTCATTCTAAAAGCTCTTTTCAGGGATCATCATCAAGGAAGCGTGATGGGGCTCACATTCACCAA
GCTCTTCAGTCGGCTTTTCGCCAAGAAGGAAATGCGCATTCTAATGGTTGGTCTTGATGCAGCTGGTAAGACCACCATATTGTACAAGTT
GAAGCTGGGAGAGATCGTGACTACTATTCCTACCATTGGTTTCAATGTGGAGACTGTTGAGTACAAGAACATCAGCTTCACTGTTTGGGA
TGTCGGAGGTCAGGACAAGATCCGTCCATTGTGGAGGCACTACTTCCAGAACACTCAGGGTCTCATTTTTGTGGTTGATAGCAATGATAG
AGACCGTGTTGTAGAAGCAAGAGATGAATTGCATAGGATGTTGAACGAGGATGAACTTCGGGATGCTGTGCTTCTAGTATTTGCTAACAA
ACAAGATCTTCCTAACGCAATGAATGCTGCTGAAATAACTGATAAGCTTGGACTGCACTCCCTCAGGCAGCGTCACTGGTACATCCAGAG
CACTTGTGCAACTTCTGGCGAGGGGCTTTATGAGGGACTTGATTGGCTTTCTAACAACATTGCTAACAAGGCTTAAAGTGATGCAGATTT
GTTATTGTGGGTTGATCCTGGATGCAGGCGGAGTTTTATCTAGTTTTTTTTACTTCTCATGTCAGTGTGGTTATGAATATCATGTTGAAA
GCATTTTGTGTTTCCTTAGGGCTTTTTGTAATGGCTGTGTAATACAATGGTCGAATATATGTAATTGCTGTTTGATTAGGTAAAAAAAAA
AAAAAAAAAACTCG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (16)  
mRNA member sequences (36)  
Alignment image suppressed for unigene with 36 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (2)  
Annotations (manual: 1 | blast: 2 | go: 7 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (2)