This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U577171, SGN-U578448, SGN-U580097, SGN-U580403, SGN-U580508, SGN-U592268, SGN-U593193, and SGN-U593730 in the current build, Tomato 200607 #2
Unigene SGN-U212804

Unigene Basic Information 
Unigene ID: SGN-U212804
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 212804
mRNA sequence: Length: 1637 bp

>SGN-U212804 Lycopersicon Combined #3 (379 members)
ATATTTTAAAAAGGGACTAAACTTAGAAGAGAAGTTTGTTTGAAACTACTTTTGTCTCTTTCTTGTTCCCATTTCTCTCTTAGATTTCAA
AAAGTGAACTACTTTATCTCTTTCTTTGTTCACATTTTATTTTATTCTATTATAAATATGGCATCCTCATATTGAGATTTTTAGAAATTA
TTCTAATCATTCACAGTGCAAAAGAAGATGGAAAGCCCTAGAGTTGAGGAGAGTTATGACAAAATGAGTGAATTAAAAGCGTTTGATGAT
ACTAAGGCCGGTGTTAAAGGACTTGTTGATTCTGGAATTACTAAAGTACCTCAAATATTCGTTCTACCGCCAAAAGACAGGGCTAAAAAA
TGTGAAACACATTTCGTTTTTCCAGTGATAGACCTTCAAGGTATCGATGAGGATCCGATTAAGCATAAGGAGATAGTGGACAAAGTTCGA
GATGCATCGGAGAAATGGGGTTTTTTCCAAGTGGTTAATCATGGGATTCCAACATCCGTCTTGGACAGAACGTTGCAAGGAACACGACAG
TTCTTTGAGCAAGATAACGAGGTTAAGAAACAGTATTACACTCGAGATACTGCGAAAAAAGTGGTTTATACTAGCAATCTTGATTTGTAT
AAATCTTCTGTTCCAGCTGCAAGTTGGAGAGACACGATTTTCTGTTACATGGCTCCGAATCCTCCCAGTCTACAAGAATTTCCAACTCCA
TGCGGGGAGTCATTAATAGACTTCTCCAAGGATGTGAAGAAACTGGGATTCACTTTACTTGAATTATTGTCTGAAGGTCTCGGTCTCGAT
CGTAGTTATCTCAAAGATTATATGGATTGTTTTCATCTTTTCTGTTCTTGCAACTACTACCCACCATGTCCTCAGCCAGAACTCACCATG
GGCACCATTCAACATACCGATATTGGTTTTGTAACGATCCTTCTACAAGATGATATGGGAGGGCTCCAAGTTCTTCACCAGAATCATTGG
GTTGATGTTCCTCCTACACCCGGTTCTCTAGTGGTGAATATTGGAGATTTTCTGCAGCTCTTGTCAAATGACAAGTACTTAAGTGTCGAG
CACAGAGCAATCTCAAACAATGTTGGATCAAGAATGTCAATCACGTGCTTCTTCGGTGAAAGTCCATATCAATCTTCCAAGCTTTATGGA
CCGATAACTGAATTGTTATCAGAAGATAATCCTCCAAAATATCGCGCAACCACAGTGAAAGACCACACTAGTTACCTCCATAACAGAGGC
CTAGATGGAACTTCTGCATTGTCCCGTTACAAGATCTAAGAATAAGAATAATAATGTTATCTATTATTACTATTTATACTTCTGCAGATT
GTACCTTTGAATTTGAAGCAAATGTTTGAGTTAAATACTTTCACGTTTCTAAGCAATGTAATATAATTTATAAAGTATGTGCATAAAAAA
AAATGTTGTTTAAAACATTAAATAATATTACATAAATATAAACACCATAATATAAGGATGTTTAGCATTGTGGGAAAAAAAAAAAAATTG
CTGGTGCACACTAAGAAAACCTCGCAGAAAAGTCATTCAATTATTTGACTTACGAAATCACTCTTCACTATTGTCATTACAGGTTCGACA
GCTACGGTAAACAGGGA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (11)  
mRNA member sequences (379)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (21)  
Annotations (manual: 4 | blast: 2 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (2)