This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U577204, SGN-U577577, SGN-U578520, SGN-U579209, and SGN-U580418 in the current build, Tomato 200607 #2
Unigene SGN-U212845

Unigene Basic Information 
Unigene ID: SGN-U212845
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 212845
mRNA sequence: Length: 1946 bp

>SGN-U212845 Lycopersicon Combined #3 (236 members)
CCCCCCCCCTTTTTTTTTTTTTTTTTTTTTTTTTTGTTCCATGCTATCAAAAAATCAAAGATTTTTTCTGAAATGAAAAATACAGTAACA
TTAGTTGACACTTCCTGGTAGCAGATAATCATGCACTCTCCAATATAAAATTACTCCTACAGAGACTAGAAATCGCACAAGGAAAACACA
ACATTTTTGCAACCCTGCATACTAGCATATGGTTTTTCTCCTCAGCTGTGCCGCATATCGCCTAATTTTTCTTCTCTAAGTTTCTTAGTG
TCTCAAGATGGGTAAAGAGAAGATTCACATCAGCATCGTGGTCATTGGTCATGTTGACTCTGGAAAGTCGACTACCACTGGTCACTTGAT
CTACAAGCTTGGTGGTATTGACAAGCGTGTTATTGAGAGGTTCGAGAAGGAAGCTGCTGAGATGAACAAGAGGTCATTCAAGTATGCCTG
GGTGCTTGACAAACTTAAGGCAGAACGTGAGCGTGGTATCACCATTGATATTGCTTTGTGGAAGTTTGAGACCACTAAGTACTACTGCAC
TGTTATTGATGCCCCCGGCCACAGGGATTTCATCAAGAACATGATCACTGGTACCTCTCAGGCTGACTGTGCTGTTCTCATTATTGACTC
CACTACTGGTGGTTTTGAAGCTGGTATCTCCAAAGATGGTCAGACCCGTGAACATGCATTGCTTGCTTTCACCCTTGGTGTCAAGCAAAT
GATCTGCTGCTGTAACAAGATGGATGCTACCACCCCCAAGTACTCCAAGGCTAGGTATGATGAAATCGTGAAGGAAGTTTCTTCCTACCT
CAAGAAGGTTGGTTACAACCCTGACAAAATCCCCTTTGTTCCAATCTCTGGTTTTGAAGGAGACAACATGATTGAGAGGTCTACCAACCT
CGACTGGTACAAGGGACCAACCCTCCTTGAGGCTCTTGACCAGATTAATGAGCCCAAGAGGCCATCAGACAAGCCCCTCCGTCTTCCACT
TCAGGACGTTTACAAGATTGGTGGAATTGGAACTGTCCCCGTTGGTCGTGTTGAAACTGGTGTAATCAAGCCTGGTATGGTTGTGACCTT
TGGCCCTACTGGTTTGACAACTGAAGTCAAGTCTGTTGAGATGCACCACGAAGCTCTCCAGGAGGCGCTCCCTGGAGACAATGTTGGGTT
CAATGTTAAGAATGTTGCTGTTAAGGATCTTAAGCGTGGTTATGTTGCCTCAAACTCCAAGGATGACCCAGCTAAGGGGGCAGCCAGTTT
CACTGCCCAGGTCATCATCATGAACCATCCTGGCCAGATTGGAAATGGATATGCACCAGTGCTTGACTGCCACACTTCCCACATTGCTGT
CAAGTTTGCTGAGATCTTGACCAAGATTGACAGGCGTTCAGGTAAGGAACTTGAGAAGGAGCCTAAGTTCTTGAAGAATGGTGATGCTGG
TATGGTTAAGATGATTCCCACCAAGCCCATGGTTGTTGAGACCTTTGCCGAATACCCACCATTGGGTCGTTTTGCTGTGAGGGACATGAG
GCAAACTGTTGCTGTGGGTGTTGTCAAGAATGTTGACAAGAAGGACCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGGGAAA
GTAGAGTGCATTTGATGAGCACGGATGAAATAGTTTTGTTTATTTGCATCAGTTTTTTTCATTTTTGTTTTGGACAGCATTTTGCCAGTT
TTGGATATGGCTACAGAAGGTATTGTCATGGTTCTCTAGCCTCTTTTTGAGGATAGTGGAGTAATTGAGCAATTATGTCGGGACCAAATT
ACTTGATGGGCAATGACATATAGCTCTGTTGGTTGTTCCTTTACCTGGGTTAAATCACTTTACACACAGTCTTGGTCACTGCTCAACTTA
TTTAAGTTTATGAAATTTTGAGTATATTTCCTTCTAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (28)  
mRNA member sequences (236)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (4)  
Annotations (manual: 4 | blast: 2 | go: 5 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (3)